VARNA: Visualization Applet for RNA

Full annotation of structure using numerical values: The Color maps example

When the colors have a semantic that is related to a numeric value (Conservation, Boltzmann probability...), VARNA offers the possibility to specify these numeric values and automatically maps these values to colors according to a color map.

• Assign a value for each base through a colorMap parameter.
• Optional: Set the color map title using colorMapTitle.
• Set the color map using colorMapStyle.
  Note: the color map is automatically scaled to match the span of values.

<applet  code="VARNA.class" codebase="bin"
    archive="VARNA.jar" width="552" height="200">
  <param name="columns" value="6" />
  <param name="sequenceDBN1"  value="ACGAUCGAUCGCAUCGACUACGAUCGC"/>
  <param name="structureDBN1" value="((((((((((.......))))))))))"/>
  <param name="colorMap1" value="2.1,3.0,7.4,3.1,1.4,0.8,9.5,1.5,
   0.1,2.9,1.7,0.6,2.5,4.5,7.3,5.2,1.5,8.8,2.9,9.9,0.5,1.2,4.3,4.4,
   6.3,8.5,7.4,2.5,0.4,8.2,0.8" />
  <param name="colorMapStyle1" value="red" />
  <param name="colorMapCaption1" value="Coolness" />
  <param name="colorMapStyle2" value="green" />
  <param name="colorMapStyle3" value="blue" />
  <param name="colorMapStyle4" value="bw" />
  <param name="colorMapStyle5" value="heat" />
  <param name="colorMapStyle6" value="0:#FFFF00;1:#ffFFFF;6:#FF0000"/>
  <param name="rotation1" value="-20.0" />
</applet>

Custom styles

Custom styles can be defined in a visual way within VARNA thanks to our gradient editor, accessible from VARNA menu (Display>Color Map> Style...).

Note to Firefox users: Certain versions of Firefox may be confused by self-signed certificates, and silently prevent the applet from running. If the frame above shows up empty, then try reloading the page.