Highlighting regions

Recent changes in Java security policy might prevent you from running VARNA.
Check out this page for details and ways to solve the problem.

Highlighting regions: A purine riboswitch example
Java Get Powered

Highlighting regions, ie sequences of contiguous bases, can be useful to draw the reader's attention toward some local remarkable feature. A sequence of regions can be distinguished through the highlightRegion command, each of which can be customized using the following, comma-separated, assignations:

  • radius=real: Thickness of the highlight
  • fill=color: The color used to fill the highlight
  • outline=color: The color used to draw the line around the highlight

Note to Firefox users: Certain versions of Firefox may be confused by self-signed certificates, and silently prevent the applet from running. If the frame above shows up empty, then try reloading the page.

<applet  code="VARNA.class" codebase="bin" archive="VARNA.jar">
<param name="auxBPs" value="(48,102):thickness=3,color=#6ed86e" />
<param name="baseInner" value="#FFFFFF" />
<param name="highlightRegion" value="48-63:fill=#bcffdd;81-102:fill=#bcffdd" />
<param name="sequenceDBN" value="UUGUAUAACCUCAAUAAUAUGGUUUGAGGGUGUCUACCAGGA
  ACCGUAAAAUGGUGAUUACAAAAUUUGUUUAUGACAUUUUUUGUAAUCAGGAUUUUUUUU" />
<param name="structureDBN" value="(((((...((((((.........))))))........((((
  (.........)))))..)))))....((((...))))........................"/>
<param name="flat" value="true" />
<param name="titleSize" value="10" />
<param name="title" value="Alternate configurations of the pbuE adenine
  riboswitch (Lemay/Lafontaine, RNA 2007)"/>
</applet>

Previous page: Adding Labels
Next page: Glyphs