Multiple panels

Recent changes in Java security policy might prevent you from running VARNA.
Check out this page for details and ways to solve the problem.

Assigning parameters for one or for all: The Warholesque example
Java Get Powered

The following code assigns different colors to each panel, while assigning a common sequence/secondary structure and title to every panel. Notice the usage of titleSize to adapt the title width to that of the panel.

Note to Firefox users: Certain versions of Firefox may be confused by self-signed certificates, and silently prevent the applet from running. If the frame above shows up empty, then try reloading the page. 

<applet  code="VARNA.class"
	codebase="bin"
	archive="VARNA.jar"
	width="400" height="300">
<param name="rows"  value="2" />
<param name="columns" value="3" />
<param name="sequenceDBN1"  value="GGGGACCAUAAUGUGUUAAGGGGCCGUAGU" />
<param name="structureDBN1" value="(((.((((....)))).((....))..)))" />
<param name="background1" value="#FFFF00" />
<param name="title1" value="Warholesque" />
<param name="titleSize1" value="16" />
<param name="background2" value="#FF0000" />
<param name="background3" value="#FF00FF" />
<param name="background4" value="#0000FF" />
<param name="background5" value="#00FFFF" />
<param name="background6" value="#00FF00" />
</applet>

^ Top

Previous page: Funky !
Next page: Algorithms