Algorithms

Recent changes in Java security policy might prevent you from running VARNA.
Check out this page for details and ways to solve the problem.

Using different representations: The algorithms example
Java Get Powered

This examples demonstrates the usage of our four different types of representations on a single RNA.

Note to Firefox users: Certain versions of Firefox may be confused by self-signed certificates, and silently prevent the applet from running. If the frame above shows up empty, then try reloading the page. 

<applet  code="VARNA.class"
	codebase="bin"
	archive="VARNA.jar"
	width=500" height="300">
	<param name="rows"  value="2" />
	<param name="columns" value="2" />
	<param name="sequenceDBN1"  value="GGGGACCAUAGGGGACCAUAAUGUGU
		UAAGGGGCCGUAGUAUGUGUUAAGGGGCCGUAGU" />
	<param name="structureDBN1" value="(((.((((..(((.((((....))))
		.((....))..)))..)))).((....))..)))" />
	<param name="titleSize1" value="16" />
	<param name="algorithm1" value="line" />
	<param name="title1" value="Linear algorithm" />
	<param name="algorithm2" value="circular" />
	<param name="title2" value="Circular algorithm" />
	<param name="algorithm3" value="radiate" />
	<param name="title3" value="Radiate algorithm" />
	<param name="algorithm4" value="naview" />
	<param name="title4" value="NAView algorithm" />
</applet>

^ Top

Previous page: Multiple panels
Next page: Base-pairs styles